This allele was generated at The Centre for Phenogenomics by injecting / electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence GCTGATGGAACAGGTAACAA and an AAV repair template to insert a Bxb1 IMCE cassette comprised of a Bxb1 attP-GT site, a spacer sequence, and a Bxb1 attP-GA stie. This resulted in insertion of the Bxb1 IMCE cassette after Chr11:3195464 (GRCm39). This insertion should enable Bxb1 integrase-mediated cassette exchange with an appropriate vector and Bxb1 mRNA. (J:322048)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count