This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AATTTAGTGGTTCTAGAGCG targeting the 5' side and ACGGCCTCTACAAGTTAGGG targeting the 3' side of a critical region (ENSMUSE00001327733). This resulted in a 740-bp deletion of Chr1 from 13013818 to 13014557 with insertion of AGGA at the deletion junction (GRCm39). Absence of this exon from mRNA is predicted to introduce a frameshift and premature stop codon. (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count