Methionine codon 440 (ATG) in exon 8 was changed to threonine (ACG) (c.1319T>C, p.M440T) using an sgRNA (targeting TACCTTAAGCATTTGCATTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.M446T mutation associated with microcephalic dwarfism. (J:343338)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count