Arginine codons 214 (CGG), 215 (CGC) and 216 (AGA) in exon 6 were changed to alanine (GCA), histidine (CAT) and alanine (GCT) (p.R214_R216delinsAHA), respectively, using an sgRNA (targeting GGGGCCGCGTCTGGGGACTTGTG) and an ssODN template with CRISPR/Cas9 technology. The mutations in the C1 domain of the encoded peptide render it heparan sulfate (HS)-binding deficient which blocks oligomerization. (J:343334)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count