Proline codon 440 (CCT) in exon 11 was changed to serine (TCT) (p.P440S) using an sgRNA (targeting CTGGGTAAGGGATTCGACCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is equivalent to the same human mutation associated with combined immunodeficiencies (CID). (J:342630)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count