CRISPR/cas9 genome editing used guide RNAs (CGCCGAATCCATCGCGTGAA, GCCGAATCCATCGCGTGAAA, TGCGTGTCTGGGCAGCCTGG, AGTTGCGTGTCTGGGCAGCC) to excise and replace coding murine exon 1 with a full-length 568 amino acid WT human SLC13A5cDNA with bGH poly(A) transcription termination signal. The insertion prevents translation of the mouse Slc13a5 cDNA. Slc13a5 transcript Slc13a5-201 (ENSMUST00000021161.14) was used as reference for the exon number and guide sequences. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count