CRISPR/cas9 genome editing used guide RNAs (CTCCCATCCACAGGCTGCGC and TTCCAGCGCAGCCTGTGGAT) to cleave DNA and a single stranded oligo donor with the silent F290F (TTC to TTT) variant and missense R292C (CGC to TGC; arginine to cysteine) variant in exon 4.The mutation is homologous to human R309C and is associated with Polg-related mitochondrial disorders. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count