CRISPR/cas9 endonuclease-mediated genome editing is used to delete exons 2-7 using sgRNA (CCCCTCCGCCAGCCTATAGCTTC,TAGGGCATTAGAGCCACTCGGG and ATATTATGGTGGCTTAGGGTAGG, CCCTCTCACATGCACGATTCACT). The 1537 bp [bps 41755833 to 41757369, using GRCm39 (NC_000070.7)] deletion includes exons 2-7, and parts of introns 1 and 7 including the nucleotides coding for the enzyme's His-Pro-His active site. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count