Cysteine codon 458 (TGT) in exon 12 (in ENSMUST00000028964) was changed to serine (AGC) (p.C458S) using an sgRNA (targeting AGAAGAAGGACGGCTGTGACTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation creates an E3 ligase-inactive form of the encoded peptide. (J:277157)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count