Serine codon 513 (TCT) in exon 6 was targeted for change to alanine (GCT) (p.S513A) using sgRNAs (targeting GTGGGTGGGGGTAATGGGTA and CCTACCCATCCAGAGTAC) and an ssODN template with CRISPR/Cas9 technology. This allele represents an untargeted 1 bp deletion (one of 3 Cs (G on forward strand) at GRCm39:chr4:125013313-125013315) that leads to a frameshift and premature stop codon (p.P517Hfs*50). Expressed peptides lack the C terminal domain (CTD) and part of the proline-rich region. (J:277918)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count