sgRNAs (ACATTTGCTGAGGCCTCAAC and CTCCAGAACGGAGAAGATGT) are used to excise the entire Mtv3 gene as well as the adjacent noncoding RNA segment. Transcript BC018473-204 (ENSMUST00000156293.8) is used as reference for the exon number and guide sequences for the Lnc non-coding RNA adjacent to Mtv3. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count