Tryptophan codon 807 (TGG) in exon 17 was targeted for change to arginine (AGG) (p.W807R) using an sgRNA (targeting TCTCAGCCACCCATGGTTAC) and an ssODN template with CRISPR/Cas9 technology. This allele represents an unintended 7 bp deletion (TACAGGT) of the last 5 bp of exon 17 and the first 2 bp of intron 17, which includes nucleotides from the last two codons of exon 17 (L and Q codons) and the core splice donor site. (J:296761)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count