Serine codons 19 (AGT), 22 (AGT) and 26 (TCC) in exon 2 were changed to alanine (GCT, GCT and GCC) (p.S19A, p.S22A, p.S26A) using an sgRNA (targeting CCTGACAGTCCAAAGGGTTCCTC) and an ssODN template. The mutations prevent the phosphorylation of the three residues in the encoded peptide. (J:342225)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count