Serine codon 42 (AGT) in exon 5 (in ENSMUST00000047321) was changed to alanine (GCC) (p.S42A) using an sgRNA (targeting GTGTGGACTGCAATCGCAAG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the affected residue in the encoded peptide unphosphorylatable. (J:342247)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count