A single nucleotide deletion (GRCm39:chr19:10200883Gdel, c.789Cdel) was engineered in exon 6 (in ENSMUST00000189897) using an sgRNA (targeting GGCAAGGCTGTGACAGTCCCAGG) and an ssODN template with CRISPR/Cas9 technology, leading to a frameshift and premature stop codon (p.N264Tfs*8). The mutation is the equivalent of the human c.789Cdel, p.S264Afs*8 mutation associated with nanophthalmos. (J:302837)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count