This allele was generated at The Centre for Phenogenomics by microinjecting Cas9 mRNA with a guide RNA with the spacer sequence AGCGGAGCAGCGGGAGCAAT and a single-stranded oligonucleotide repair template. This resulted in the insertion of a FLAG tag at the N-terminus. (J:334420)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count