Prr16^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGCTGTAGATCAGAGGTCA and TGGTAGTGGTGGATTTCCTC, which resulted in a 708 bp deletion beginning at Chromosome 18 position 51,302,635 bp and ending after 51,303,342 bp (GRCm38/mm10). This mutation deletes 708 bp from ENSMUSE00000707416 (exon 2) and because of the 1 bp G insertion is predicted to cause a change of amino acid sequence after residue 61 and early truncation 12 amino acids later. There is a 1 bp insertion (G) at the deletion site. (J:188991)