Two mutations were introduced in intron 2 using a crNA (targeting TGGGGGCTCTGACTGTTTGA) and an ssODN template with CRISPR/Cas9 technology: c.175-106A>G and c.175-76G>A. These mutations are the equivalent of human SNPs rs884785 (c.175-56A>G) and rs884786 (c.175-27G>A) found in some left ventricular noncompaction (LVNC) patients. (J:338889)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count