Valine codon 943 (GTT) in exon 20 was changed to phenylalanine (TTT) (p.V943F) using an sgRNA (targeting CTGCACATCTGCGTTAACAT) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the same human mutation (c.2827G>T) found in some left ventricular noncompaction (LVNC) patients. (J:338889)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count