Arginine codon 530 (AGA) in exon 11 was changed to a stop codon (TGA) (p.R530*) using an sgRNA (targeting TACGCTTATTACGAGCATTC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the same human missense mutation (c.1588C>T) found in some left ventricular noncompaction (LVNC) patients. (J:338889)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count