This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTCAAACTTAACTGCCCACG targeting the 5' side and GCTTCAGGGCTGCTATTCGA targeting the 3' side of a critical region (ENSMUSE00000256977). This resulted in a 2320-bp deletion of Chr7 from 122848218 to 122850537 (GRCm39) introducing a frameshift and premature stop codon. (J:265051)