Glycine codon 416 (GGT) in exon 12 was changed to arginine (CGG) (p.G416R) using an sgRNA (targeting GTGATTATCCGAGGGGCTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the human p.G414R mutation found in a patient with a neurodevelopmental disorder. (J:339227)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count