A T-to-C nucleotide change was engineered in the 3' UTR (GRCm39:chr3:79364590A>G) using an sgRNA (targeting GATAAGTGATATGAATGTAT) and an ssODN template with CRISPR/Cas9 technology. This mutation represents a human T>C mutation (SNP rs2299007) in the 3' UTR that affects miR-181b-5p binding and is associated with metabolic and obesityrelated phenotypes. (J:339560)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count