CRISPR/cas9 genome editing uses guide RNAs (GGGATATTTTAGGAGCCTGA, ATATTTTAGGAGCCTGAGGG, ATTCCTTCGCCTACATCCAG, TTGCCACTGGATGTAGGCGA) to excise and replace murine exon 3 with a loxP-flanked wild type exon 3 cassette. Slc37a4 transcript Slc37a4-201 (ENSMUST00000165839.3) was used as reference for the exon number and guide sequences. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count