This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATAGCCTCTCAGATGCACA and AAGTAGTTATTAGGTGGCAG, which resulted in a 538 bp deletion beginning at Chromosome 19 position 24,834,581 bp and ending after 24,835,118 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001204964 (exon 2) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 75 amino acids later. (J:188991)