Eprs1^em1Foxp

Exon 32 (last exon) was targeted with an sgRNA (targeting TTCAACCCTCTGTGTGAGCT) using CRISPR/Cas9 technology, resulting in the insertion/duplication of an A (GRCm39:chr1:185160256dup), which leads to a frameshift and premature stop codon (NM_001357474.1:c.4472dup:p.N1491Kfs*5). This mutation disrupts the ZBD domain in the encoded peptide. Transcription, splicing, transcript nuclear export and translation are normal, however, the expressed protein is highly unstable, with ~1/3 of the WT half-life. (J:339761)