Cysteine codon 284 (TGT) in exon 5 was changed to arginine (CGT) (p.C284R) using an sgRNA (targeting GAAGACGATGGGTATACAGTCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the same human mutation (SNP) associated with early-onset Crohns disease (CD), ankylosing spondylitis, systemic juvenile idiopathic arthritis and a high-risk state for leprosy. (J:339910)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count