Serine codon 226 (TCC) in exon 3 was changed to alanine (GCT) (p.S226A) using an sgRNA (targeting GCGGGCCTCCTGCAAATACG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the histone binding domain of the encoded peptide, affects histone H3.3 binding. (J:340029)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count