Cgas^em1Anda

Mutated exon 2, where arginine codon 241 (AGA) was changed to glutamic acid (p.R241E), was inverted, and a lox71 site was inserted into intron 1 and a lox66, in opposite direction, into intron 2 using sgRNAs (targeting TTTATAGGCACCCTATGTACAGG and CTGACCGCACGACTTACCCTGGG) and an ssODN template with CRISPR/Cas9 technology. The allele is a knockout and only after Cre-mediated flipping of exon 2 will it express the mutated transcript/peptide. The mutation, the equivalent of the human p.R255E mutation, affects ageing-associated neurodegeneration. (J:340265)