Asparagine codon 159 (AAC) in exon 5 was changed to serine (AGT) (p.N159S) using a crRNA (targeting GCAGTTTAATATGACGGAGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.N160S dominant-negative mutation associated with combined immunodeficiency (CID). (J:340322)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count