Pacs1^{em5(PACS1*R201W)Lutzy}

Guide RNAs (CCAGAGGGCCTGGTACTGCA,AGAAAGAAAGAAATGCCAGA,GGGCTATAAAACCTTAGCTG, and GGCTATAAAACCTTAGCTGT) are selected to excise and replace murine exon 4 with a human exon 4 containing the R201W (CGG to TGG, arginine to tryptophan, c.601) variant. A loxP-flanked STOP cassette, which contains a splice acceptor and 3x SV40 polyadenylation sequence is inserted into intron 3/4. Mouse Pcs1 transcript Pac1-201 (ENSMUST00000025786.9) and human PACS1-201 (ENST00000320580.9) were used as reference for the exon number and guide sequences. The mutation is orthologous to the human R203W mutation. (J:94077)