Tex47^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCTTTCATGGTCCATAAT and GCCACACAATATCGGAATCC, which resulted in a 713 bp deletion beginning at Chromosome 5 position 7,304,836 bp and ending after 7,305,548 bp (GRCm38/mm10). This mutation deletes 713 bp from ENSMUSE00000554423 (exon 2) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 34 amino acids later. (J:188991)