Glutamic acid codon 1020 (GAA) in exon 22 was changed to lysine (AAA) (p.E1020K) using an sgRNA (targeting GAGCTTCGTTGAACTTCACCCGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.E1021K gain-of-function (GOF) mutation associated with PASLI (p110delta-activating mutations causing senescent T cells, lymphadenopathy, and immunodeficiency) disease. (J:292599)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count