Slc38a9^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAATAGTCAAGAGTCTCAC and GCCAGCAGGAGCTTAAGTTA, which resulted in a 1350 bp deletion beginning at Chromosome 13 position 112,689,111 bp and ending after 112,690,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000408687, ENSMUSE00000378819, ENSMUSE00000338903 (exons 4,5,6) and 1070 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 81 and early truncation 37 amino acids later. (J:188991)