This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGTTTCAGAGATTCCAAC and CCAAGGACCTACCAAGGACC, which resulted in a 631 bp deletion beginning at Chromosome 17 position 25,122,707 bp and ending after 25,123,337 bp (GRCm38/mm10). This mutation deletes 631 bp from ENSMUSE00000362194 (exon 2) and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 11 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count