Lsm12^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAAAGTGTACCAGGGCAGCG and CCTCTTTTCTATTCTTCCCG, which resulted in a 452 bp deletion beginning at Chromosome 11 position 102,166,982 bp and ending after 102,167,433 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226230 (exon 3) and 342 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 86 and early truncation 1 amino acid later. (J:188991)