Lysine codon 658 (AAG) in exon 21 was changed to asparagine (AAC) (p.K658N) using an sgRNA (targeting CATGGATGCGACCAACATCCTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the SH2 domain of the encoded peptide, is the equivalent of the same human gain-of-function (GOF) mutation associated with T cell large granular lymphocytic leukemia (T-LGL). (J:340910)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count