Threonine codon 716 (ACG) in exon 23 was changed to methionine (ATG) (p.T716M) using an sgRNA (targeting CAGGTCAATGGTATTGCTGCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the TA domain of the encoded peptide, is the equivalent of the same human gain-of-function (GOF) mutation associated with T cell large granular lymphocytic leukemia (T-LGL). (J:340910)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count