Arginine codon 150 (CGC) in exon 5 was changed to histidine (CAC) (p.R150H) using an sgRNA (targeting CCCGCTCCGTGCTTAGCAGCTTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R166H mutation (SNP rs148755202), a protective variant identified in some multiple sclerosis (MS) patients. (J:340937)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count