Serine codon 55 (TCA) in exon 3 was changed to leucine (CTG) (p.S55L) using an sgRNA (targeting TAGCCGTGGGCTCAGCTGTA) and an ssODN template using CRISPR/Cas9 technology. The mutation is the equivalent of the human p.S59L mutation found in a family with ALS, frontotemporal dementia (FTD) and myopathy. (J:295994)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count