Threonine codon 919 (ACG) in exon 3 was changed to aspartic acid (GAT) (p.T919D) and asparagine codon 922 (AAC) in exon 3 to alanine (GCC) (p.N922A) using an sgRNA (targeting CGTGTGTAACATATGCGGGC) and an ssODN template with CRISPR/Cas9 technology. The mutations affect the AT-binding zinc finger in C2H2 zinc finger cluster 4 (ZFC4) of the encoded peptide. (J:303180)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count