Isoleucine codon 107 (ATC) in exon 1 was changed to alanine (GCC) (p.I107A) using an sgRNA (targeting CGTACATGTTGACAAAGATG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.I109A mutation that eliminates beta-arrestin recruitment by the encoded G protein coupled receptor after activation. (J:303185)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count