Serine codon 722 (TCC) in exon 19 was changed to alanine (GCT) (p.S722A) using an sgRNA (targeting TCCGTTCAGTGAGCTCCTATGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide to a phosphoblocker. This allele was created in mice that carry the Rptorem2Rjsh allele (p.S792A mutation). (J:303713)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count