Tyrosine codon 433 (TAT) in exon 12 was changed to phenylalanine (TTC) (NM_001025074:c.1298_1299delATinsTC, p.Y433F) using an sgRNA (targeting TCCTCAGGTCTATGCCGTGGTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation, in the CARC domain of the encoded peptide, affects BDNF-induced translocation of NTRK2 to lipid-raft regions on the neuronal surface. (J:303948)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count