Glycine codon 367 (GGG) in exon 10 was changed to arginine (AGG) (c.1099G>A, p.G367R) using an sgRNA (targeting TAATACGACTCACTATAGGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human c.1117G>A (p.G373R) mutation associated with megalencephaly polymicrogyria polydactyly hydrocephalus (MPPH) syndrome. (J:304006)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count