Arginine codon 620 (CGG) in exon 14 was changed to tryptophan (TGG) (p.R619W) using a crRNA (targeting AAGACTCGGGTGTCCGTTCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R620W mutation associated with multiple autoimmune disease. This allele was created in mice containing the Tg(TcraTcrb)1100Mjb and Ptpn22tm2.1Ciphe alleles. (J:304128)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count