Exon 18 was targeted with an sgRNA (targeting GGTCCTCTTCGCTTAAATACTAG) using CRISPR/Cas9 technology, resulting in a 7 bp deletion (GAAGCGA) that leads to a frameshift and premature stop codon (NM_026789.5:c.2865-2871del, p.K956Ffs*4). This mutation essentially mimics the human c.2872C>T (p.R958*) mutation associated with male infertility. (J:333969)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count