Arginine codon 1684 (CGT) was changed to histidine (CAT) (c.5051G>A, p.R1684H) using an sgRNA (targeting CCCACCGTTCTGGGAGCTACCGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human c.5054G>A p.R1684H mutation associated with autism. (J:334099)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count