Hmgxb4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAACATTCTCCAGTCACAG and ACATACTGTAACCTAGGCTG, which resulted in a 365 bp deletion beginning at Chromosome 8 position 75,020,168 bp and ending after 75,020,532 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001311661 (exon 6) and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 398 and early truncation 21 amino acids later. (J:188991)