Proline codon 1635 (CCT) in exon 33 was changed to leucine (CTT) (c.4904C>T, p.P1635L) using an sgRNA (targeting GCCACCAGGGAGAGATGGCGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the rare human POLR1A c.4913C>T (p.Pro1638Leu) mutation associated with craniofacial, neural, and cardiac anomalies. (J:335489)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count